Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14698F12
Clone ID IST14698F12
Vector VICTR76
Project tigm

Sequence tag IST14698F12BBF2
Sequence
AGGANANNANCCTTATGCCTGCTCCTGGGACGGCTGTGACTGGAGGTTCNCTCGNNNNNACNAACTGACNCNCCACTACC
GGAANCNCNCTGGACATCGTCCCTTCTGCTGTGGCCTCTGCCCACGTGCTTTTTCACGCTCTGACCACTTAGCTCTGCAC
ATGAAGCGTCACCTCTGAGTGATCCTGCACAAGGACTGGGGATGAAATAAGAGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14698F12HMF1
Sequence
CTTANNCTGCATGGTGGCAGCATGACACAGCAAGGCCCTGTGGATTAGGCCTTGAATGCTCTTGGGGGGATCTGGACAAA
GA
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95031197..95031277 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es