Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10657E9
Clone ID IST10657E9
Vector VICTR76
Project tigm

Sequence tag IST10657E9HMF1
Sequence
TTTTTATTTATTTTTTTTAANATTTATTTATTTATTTTATGTAAGTACACTGTAGCTGTCTTCAGACACTCCANAANAGG
GCGTCAGATCTTGTTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCGGACCTTCGGAAGAGCAGTC
GGGTGCTCTTACCCACTGANCCATCTCACCAGCCCTGTTTTATTTTTTGAGACAGTCTTACCTANTATCTCTGGATGCCC
TGGGACTCATGTANACCAGGCTAGCCTCAAACTCANAGGTGCACTGGCATCTGCCTCCCAAGTACTCTGATTAAAGGTGT
ACAGCACCNCACCTGGCTGAAGTTCCCTCCTTTCANATGACTCTAGCTTGTGTCAAGTTA

Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135167003..135167380 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST10657E9BBF1
Sequence
ATTTTATTTATTTTTTTTAAGATTTATTTATTNATTTTATGTAAGTACACTGTAGCTGNCTTCAGACACTCCAGNAAGAG
GGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135167002..135167092 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es