Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11802H4
Clone ID IST11802H4
Vector VICTR76
Project tigm

Sequence tag IST11802H4HMF1
Sequence
GCTGAAGCCTGGACTTGCCCCACTGCCAGGGGAAGGAATGTGGTCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132672860..132672908 49
NO GENE  


Sequence tag IST11802H4BBF1
Sequence
ATTGTTATATGTAAGTACACTGTAGCTGTCTTCANACACTCCANAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2063 UNI36742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62243385..62243445 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 83856427..83856487 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 144751826..144751886 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029617 (AU022870) NM_177682 UPF0550 protein C7orf28 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8C1Y8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 49184483..49184543 57
NO GENE  

 
Come back to gene ENSMUSG00000029617


For any suggestions or comments, please send an email to unitrap@crg.es