Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12355F11
Clone ID IST12355F11
Vector VICTR76
Project tigm

Sequence tag IST12355F11BBF1
Sequence
CTGTAAAGGTATGTGCATAAGTACAGGTCCCCTTGGAGGCCAGGACATCAAATCCCCTAGAGCTACAGTGGGATGTTAGC
AGTACAATGCAATGAATTCAGGTCCTCTGGAAGAACTGTTAAACTAATCACTGAGACACCTCTAGCACCATGCACGTCTT
TCTGTATTTGTTTGAAGTGCTTTGTTTTCAAATGTGTATGTGTGTGCACCTGAGTGTGTATGTATACCACATGCATGCAG
GAACATGTGAGATCAGAAGAAGGTGTTGGATGCCCTGCAACTATAGTTAAAGGGTAATTGTGAGTCTCCAGGTAGATGTT
AGGAACCAAAGTTGGGTATTCTCCAAGAGCACTAAGTGTACTTAACCATCTCTCCAGTCTTGAGTGGGGTTTTTGAGTTT
TTTTGGTTGTTGTTTGTTTGTTTTTTGCCTTTGTTTGCTTGAATCTACTACCAAGGGATCAAATCCNTGGCTGTNANCAT
GCAAGANACATGCTACNNCTGANCTGCATCTCTAGCCTCGTGCTTCANGTCTNAAACTTANNCNAN
Sequence Type genomic DNA
Unitrap ID UNI5091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20134767..20135306 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es