Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10906E2
Clone ID IST10906E2
Vector VICTR76
Project tigm

Sequence tag IST10906E2HMF1
Sequence
CTAGAGTCCAAATAAAAATGTAGGGGTTACACATGCTTATAATCTCAACACTGAGAACAGGGATAGAAGACTGCTGGAGC
TTTCTGATGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82856902..82856991 90
NO GENE  


Sequence tag IST10906E2BBF1
Sequence
CTAGAGTCCAAATAAAAATGTAGGGGTTACACATGCTTATAATCTCAACACTGAGAACAGGGATAGAAGACTGCTGGAGC
TTTCTGATGGCCAGGCTCTTGTCTTTGAATCAGCAGAAGACTGTTTCAAAGGACCAAGAGTGATATGATAGAACAGAACA
CCCACAATCATCCGTATCCTATGCATGCACTCATGGGAGGATGGACGGAAGGACAGACGGACAGACAGACNGACACACAC
ACACACACACACACACACNCNTTTTANANNANAAAAAATANNTNANNTNNANNTGAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82856902..82857181 262
 
EST/CDNA Est Name
  CA544635.1 - AI049268.1 - CN668105.1 - CJ178673.1 - CJ178532.1 - BB843048.1 - CJ084419.1 - CJ078852.1 - BY305169.1


Sequence tag IST10906E2HMR1
Sequence
CTAGGGATTTGAACTCTGCTCCCCATCCCTTGCTTGTTCAGCAAGTACTGTTGTCTGCTGAACCAAATTCCCAGGCATAA
TTTTATTTTTAGTCC
Sequence Type genomic DNA
Unitrap ID UNI7138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82856812..82856905 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032253 (Phip) NM_001081216 pleckstrin homology domain interacting protein Gene [Source:MGI Symbol;Acc:MGI:1932404]

 
Come back to gene ENSMUSG00000032253


For any suggestions or comments, please send an email to unitrap@crg.es