Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10905B5
Clone ID IST10905B5
Vector VICTR76
Project tigm

Sequence tag IST10905B5HMR1
Sequence
TAGGCTTCATGGCTGGTACTTCTCATCAAAACTAATGCTGTTTGAAATACCAAGCTAGTGGCCAT
Sequence Type genomic DNA
Unitrap ID UNI33482

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115532639..115532702 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040282 (BC052040) NP_997147 Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G0]

 
Come back to gene ENSMUSG00000040282


For any suggestions or comments, please send an email to unitrap@crg.es