Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14257H6
Clone ID IST14257H6
Vector VICTR74
Project tigm

Sequence tag IST14257H6BBF1
Sequence
GGCTCAGTGGGTAAGAGTACCCGACTGCTCTTCCAAAGGTCCAGTGTTCAAGTCCCAGCAACCACATGGTGGCTCACAAC
CATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30823 UNI36744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 118173491..118173588 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29326436..29326533 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70370374..70370471 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 94950582..94950679 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59855183..59855280 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026987 (Baz2b) NM_001001182 bromodomain adjacent to zinc finger domain, 2B Gene [Source:MGI (curated);Acc:Baz2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 44877300..44877397 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47405473..47405570 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007613 (Tgfbr1) NM_009370 transforming growth factor, beta receptor I Gene [Source:MGI (curated);Acc:Tgfbr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65914771..65914868 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 90395280..90395377 98
NO GENE  

 
Come back to gene ENSMUSG00000007613


For any suggestions or comments, please send an email to unitrap@crg.es