Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11677F5
Clone ID IST11677F5
Vector VICTR76
Project tigm

Sequence tag IST11677F5HMF1
Sequence
TACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCNAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI14014 UNI36746 UNI36747 UNI36748 UNI36749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95501537..95501595 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034066 (Farp2) NM_145519 FERM, RhoGEF and pleckstrin domain protein 2 Gene [Source:MGI (curated);Acc:Farp2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62900209..62900267 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 38590259..38590317 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78163325..78163383 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 22150656..22150714 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71186737..71186795 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 73393035..73393093 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036661 (Dennd3) NM_001081066 DENN/MADD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146009]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 33877034..33877092 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24753926..24753984 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87078779..87078837 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107025029..107025087 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057375 (Yipf1) NM_145550 Yip1 domain family, member 1 Gene [Source:MGI (curated);Acc:Yipf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 50068764..50068822 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109738634..109738692 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032478 (Nme6) NM_018757 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI (curated);Acc:Nme6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100842991..100843049 57
NO GENE  

 
Come back to gene ENSMUSG00000032478


For any suggestions or comments, please send an email to unitrap@crg.es