Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10854G4
Clone ID IST10854G4
Vector VICTR76
Project tigm

Sequence tag IST10854G4HMF2
Sequence
GGCTTTAATCTCAGCACTTAGGAGGCAGAAGGCAGGCAAATCTCTGAGTTTGAGGCCAACCTGGTCTACAGAGTGAGTGC
CAGGACATCCAGGGATACACANANAAACCTTGCCTGGATAACAAACAAACAACACTTCGGGGGCATANTTTTATTTTTTT
AAAGACTTATTTTACTTANTCTCCATGTACAGATATGTGCAATACATACTGCCTACNGNAAGGGTTGTGATANANGACTA
NAAGAAAGGATTTTTACCCACTCCTAANAAATAAAAGTTTCCTTTGACCTCTGCGCACTCATCTCGACCTCTATCAGANG
TCCTAAAGTCCAATTCCCAACAACCACATGAAGGCTCACAACCNTCTATACAGCTACAGTGTACATTTCCATGTTAGTCC
NTCATTGAAGGATGTCNNGACAGCTACTCANANCANNAACCTGGANGCGGATGATGCAGANATCATGAANGAGTGCTGCT
TNCTGGCTTGCTCCTTGTANTTTGNTCNNCCTGCTTTCTTTTTTTCTTTTTTCTTTTTNTNANNNTNATTTGTTNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10854G4BBF1
Sequence
NGCTTTAATCTCANACTTANGAGGCAGAAGGCAGGCAAATCTNTGAGTTTGAGGCCAACCTGGNCTACAGAGTGAGTGCC
ANGACAT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10854G4HMR1
Sequence
GTGGCGGTCACAGTTGTTGTGGAAGCCTTAGCTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713908 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es