Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14032G12
Clone ID IST14032G12
Vector VICTR74
Project tigm

Sequence tag IST14032G12HMF1
Sequence
CCGGGAAGCTGGGAGAGAGACCTCCGTCCCGCGGCCTGCAGAGCGGACCCTTCGTGGAGACCCGAGTGAGTGCGCGGGCT
TGCGGGCGGGGGACGCCCACACTGGTCCACTCCCCTGCTGCCCCTCTCCGGATCCGCCCCTGTTTCGCTCTCCATCACTC
TCTTTGATCCTGGGGTACCTAGTTTCGAGTGCGGCCCTCTCCTAAGCGGAGAGCGTTTCCTCCTTGACCTCCTTCCCCAT
TTATTCACGCCTCACTCGTTATGTTTTCCTTGCCCCCCCCCCNNAA
Sequence Type genomic DNA
Unitrap ID UNI35139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81688149..81688430 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078960 (Tob2) transducer of ERBB2, 2 Gene [Source:MGI Symbol;Acc:MGI:1888525]


Sequence tag IST14032G12BBF1
Sequence
CCGGGAAGCTGGGAGAGAGACCTCCGTCCCGCGGCCTGCAGAGCGGACCCTTCGTGGAGACCCGAGTGAGTGCGCGGGCT
TGCGGGCGGGGGACGCCCACACTGGTCCACTCCCCTGCTGCCCCTCTCCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81688297..81688430 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078960 (Tob2) transducer of ERBB2, 2 Gene [Source:MGI Symbol;Acc:MGI:1888525]

 
Come back to gene ENSMUSG00000078960


For any suggestions or comments, please send an email to unitrap@crg.es