Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15054A7
Clone ID IST15054A7
Vector VICTR80
Project tigm

Sequence tag IST15054A7BBF1
Sequence
CCCAGGTTGCTCAAGATTTGGACAATGGAAGTGACTTTCAGTGTGTTCTTATGCTGGTCAGATGTGTTGTAGAGAGAATA
TCTTATGGCTGTATGGGCGTGGCACCTGTCAATAATAAATCTGATGGCCTATGGCTTAGGCAGGAAATTGGAGGTGGGAC
ATCTGGGAGGAGAAAGGATTCTGGGATAGAGCCAGGTGGGAGGTTCCACGTGGCAGCATGTAGATCAGAATGAATGGGTT
ATATTAAATTATGATCTAGTGAGAGAAGCGCCTAGCTATAAGCCAGGGTATTTGTAAATATATTTTGAGTCTTATTTCTG
GGAGCATGGAGTAGGAGAATGACCAAACTTCTACAATGTTTTCCTTTTTTTTTNAAAATTTATTTATTTATTTATNANAT
NNNANTACACNGNNNCTGTCCCCAAACATGCNCNNNANNAGGGCATTGGATCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15054A7HMF1
Sequence
CAACTTAGCCNAAATGCACAAGTTATAAGAAATATAGCAAACAAAAGCTTACTATCTAAAGAACTCTATTAGGGAAATAC
ACTGGTGGGTGAATTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147076446..147076541 94
NO GENE  


Sequence tag IST15054A7HMR1
Sequence
NNNTTGTTGAGTTTATTANTGAACACTGTTGGCCTGTCCCCTGCCGCTTCTCCCCAGTGCTGCTCCCCTGCTGCTGTGGA
CTCCAGCTGGAGTTAGCTTCCTCCCCTCCTCCTCTCGCCTCTTCGCCTCTTCTCACAGACTTTGCTTAAGGCTTTGCTTA
GGACTGTGTTAGAGGAGGTGCACACTGAAGTACTTATTGGTGAAGTGGTATGGTATCTGGAATTTGATTCAAAATAAGTC
AAGAGATAGAGAGAGGAATGAACTTGAATGCACATACAGTACAATGACTGAGTGACAGGGTGAACGCAGGGAGACTATGG
AGCAAAAGTATGGAAGGAAAGGATTCCATCTTTGCTCGCCCTGACTCCCGCTTTCCCTTAACCTTTCAGTACCTCTCTGA
CACCTCTTGTTATCACCTTGCACACACTCAGTTTGGTCCTTTAATAATATTTATTACAAATAAAAATCTTANGATTCCTG
TTGATTATTGTGATCTATTGCCACCCCTATGCANGATAGACTGTGACACACAACAGCATGGCCTANATTTTGTGCAGTCA
TTCTTCNGGAAGCATTTATNANNNGGGANGAN
Sequence Type genomic DNA
Unitrap ID UNI28357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147076539..147077126 568
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es