Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14541E2
Clone ID IST14541E2
Vector VICTR74
Project tigm

Sequence tag IST14541E2HMR1
Sequence
TANGACAAGAACCTTTTANANGGGCGTTCAAGGANACTATGGGGCTGAAGGGAGCTGCCAATTTCCCTGCGTTCACAACG
ACTTTTACAATGCCTCTGCAATTTACTGCCTGCCCCACGAGCTGACTGGACCTTGTCCCCAGCCATTTCGGGAATGATCA
TGCTAATGATGCATGCTAGTTTGAATTCTAGGCTGACAGGCTCTCTGTTTTTCCTACCTTTGGACTTTCCAGTACTAATC
CAATGCTTCCCATTCANAAATCCCTTGCTGAAGGTTTGGCAGTAAATGATGAAGANGATGTATGTGGGAAACAGGANCTG
CATCCTGGGGGTATCCNCAGGTTTTGAGTATCTTTTGTTCNGAACAGTGTCCCATCCCAGCCTTANCGGGCTNCANGCAT
TTANAANCGTTCCNNNNGGGGAGTTCTGTTCCCCNGTGGTGTNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14541E2HMF1
Sequence
AATGGAGATGAAGGCCGACTGGGCCAGGAGTGTATGGGAGATGATCAGGACTTTGACCACCAGACACAGAGGACGCTGCT
GGACCCTGCAGAAAGCAGCTCAAGATAGATGCAGGCTAAAAAGTCAGTTCCTAGGAAGTGTGTATCCACGCCCCATACCT
GAGCTCTGCCCGTTTCCAAGGAAAGGGCAACTTGTGATTAGGGCCTGGGTTTCATTTCTGTACCCTCCTCCATCTCCCTT
TGCTGGCCTCTGGCCTTTTGACACATACATAAGGAAACCTCCCTAAAACAAAGGCTAAGAATACTTCCCTTAGGCACACC
CTTGTATCTTTTGTTGTTTTATTTGAGATGGAGGAATCACTATGTAGGCTGGTTTGGAATTCCCTATATAGACTAGGATG
ACCTTGAATTCACAGTGATCCAGCTGCCTCTGCCTCCTGANGTGGGATAACAAGGGGGACAGGACCCACGCCTTTCATGC
ATGCTGGGCAAGCCCTCCAACCCTTGATTGTTCTCCCTTNNATGTATAAATCTCANANCCTTCACAGTGNTCTTTCNNNG
CTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122720166..122720730 547
 
EST/CDNA Est Name
  CN675301.1 - BF019192.1


Sequence tag IST14541E2BBF2
Sequence
ACATCAAGTGTCTTCTGGCCCTGAGTGGCTCTCTCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22140993..22141034 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es