Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14191A9
Clone ID IST14191A9
Vector VICTR74
Project tigm

Sequence tag IST14191A9BBF1
Sequence
AGGGAAGGGCCCCTGAACTTTTCAGGGCATGCTCCTGGGAGGAGACAGCTCACAAGCATGGAACAGTGGAAGGTTTGCGC
TCACCATCACCGTCAGGGTCTGCTTTGATTGCAGAGTACATCTCCTGAATGTTCTCTGGAGTCATCCACCGTCCATTTCC
CAGGCGAGTCTGGGCCAGGACCTAAAGCAGAGTAGCAAAGAATCACCANAACAGACAGGACACGGGGCTTGCTATANAGC
TAAAGGTTTTATTGCCAGGGCATGAGTGAANAAGACACAGGAACGCCGANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108485094..108485387 286
 
EST/CDNA Est Name
  BY573247.1 - BB733447.1 - W53802.1 - CF533944.1


Sequence tag IST14191A9HMF1
Sequence
AGGGAAGGGCCCCTGAACTTTTCAGGGCATGCTCCTGGGAGGAGACAGCTCACAAGCATGGAACAGTGGAAGGTTTGCGC
TCACCATCACCGTCAGGGTCTGCTTTGATTGCAGAGTACATCTCCTGAATGTTCTCTGGAGTCATCCACCGTCCATTTCC
CAGGCGAGTCTGGGCCAGGACCTAAAGCAGAGTANCAAAGAATCACCAGAACAGACAGGACACGGGGCTTGCTATAGAGC
TAAAGGTTTTATTGCCAGGGCATGAGTGAAGAAGACACAGGAACGCCGAGATCTCANTGCANTTCANTGATAGCCATGAA
GGNNNNNNNAAAGGAGGTACATGTGCCTGCGGGCTATNTCNATCCNCNNACCTGCTGAAGGCNNAATGGANNCAGGCCCC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14191A9HMR1
Sequence
CCCTTGCAGCAGGCAGCTTTCATGCCCAGCTTTGAAAATGCACAGAGTTAGGGAGGTGAGGATCTAGGTTTCTATCGAAC
CTANAGTGAAAATTCAGCTGGAGCCTGTGGCTGGCTCTCAATCTAGGCCAAAGGATAGAACAATTACANCAAAGCCACCC
ACTCTTCCANANCCCCAGAGGGATACCTCTGCTTANTGGTCTGANCNNGAAGAGAGGAGCCTTCTCATCTGTGGGGTGGT
CAGGANTTTGGGGTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI22770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108484835..108485097 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es