Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13659G7
Clone ID IST13659G7
Vector VICTR74
Project tigm

Sequence tag IST13659G7BBF1
Sequence
CTTTGACNATTCTACCACCTATACCAATGGTTTTCAACCTGTGGGTCTCAACCCCTTTGTAGGTAGGGTATTAAATGATC
CTTTCACAGGGGCCAAATGTCAGGTATCCTGCGTATCAAATATTTACAGTATGATGCATAACCTTAGTAAAGCTATGGTT
ATGAAGTAACAACGATTATTTAATGGGGGGCTGGAGAGACAGCTGCTCTTCCAGAGGTCTCANCACCCACATGGTGGCTC
ATAACCNTCGATAATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95166851..95167112 254
 
EST/CDNA Est Name
  CK335698.1 - BY182129.1 - BY178293.1 - BY082205.1 - BY307643.1 - BY231243.1 - BY061634.1 - BB842891.1 - BY767360.1 - BY776735.1 - BY217662.1 - BB842892.1 - BY097710.1 - BY198571.1 - BY047243.1 - BY035991.1 - BY014790.1 - BY234205.1 - BY016249.1 - BY174862


Sequence tag IST13659G7HMR1
Sequence
AAAGTGTAAGGCAGCTGCTGAAATACTCGGTCTTCAAAGTGGTTTCTGTCAGATGTTCTTTTATAGGCAGTGGCTTATAT
AAATGTGAGATGCAGGTGTCTTGAAGACTGTATGGCGTTCGTTATAGGTCATCGTAAAACGATAAAATGGGAATGTTATC
TCATCACTATAAAATGGCTTAAGAGTTAAATTGCTTATTGAGTGTGTCAGTGAGATTTAATGCTTCTAAAGGTACTTTTA
ATTCTAGAATATAGAGTCACATTTGATAGAATAACTTTGAATAAATATTCAGAATGTTGCTTTGGTAGTGAAATAAACAA
AAGGCTTGTGGTTAGAAGTACTTGGAAGGCTCTCTAATGTANNNNNNCNCTTGGGCTTATGTANAAAGTAGGCTTTTCCC
CTCCTAGTTTTANTN
Sequence Type genomic DNA
Unitrap ID UNI22

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95166444..95166854 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es