Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11419H1
Clone ID IST11419H1
Vector VICTR76
Project tigm

Sequence tag IST11419H1HMF1
Sequence
ACACAATGGCGAGTCCTTGAATGTGCACCCCCACTGATATGCAGGGATCCCCGTGAGAACACTTGTTTGTTTCCATTTGT
TGTTTGTTTCACTTTGGGTTTTTTTTTGTTTTTGTTTTTTTTTNNGN
Sequence Type genomic DNA
Unitrap ID UNI5712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55064736..55064858 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST11419H1BBF1
Sequence
ACACAATGGCGAGTCCTTGAATGTGCACCCCCACTGATATGCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI5712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55064736..55064784 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es