Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15082A8
Clone ID IST15082A8
Vector VICTR80
Project tigm

Sequence tag IST15082A8HMR1
Sequence
AACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCNNACCCCANAAAAGGTGTTGGTTGATATAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15082A8HMF2
Sequence
CGGTTCATCCCGCAGCGCCAGTTCTGCTTACCAAAN
Sequence Type genomic DNA
Unitrap ID UNI438 UNI21593 UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44965008..44965042 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038518 (Jarid2) NM_021878 jumonji, AT rich interactive domain 2 Gene [Source:MGI Symbol;Acc:MGI:104813]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105115019..105115053 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391227..57391261 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20821798..20821832 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036591 (Arhgap21) NM_001081364 Rho GTPase activating protein 21 Gene [Source:MGI (curated);Acc:Arhgap21-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 44743259..44743293 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15520087..15520121 35
NO GENE  


Sequence tag IST15082A8BBF1
Sequence
CGGTNNNNNNNNNNNCGCCNGTTCTGCTTACCNNNAGTGGCCCACTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAG
CGAGCCGGGCTTCTTACCCATTTAAAGTTTGAGAATAGGTTGAGATCGTTTCGGCCCCAAGACCTCTAATCATTCGCTTT
ACCGGATAAAACTGCGTACGTCGGGAGCGAGAGCGCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATG
GTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGT
TTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTNACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGG
CGCGGCGGGCGAGACGGNCCGGTGGTGCGCCCTCGGCGGACTGGANANGCCTCGGGANCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391242..57391688 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es