Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14571H1
Clone ID IST14571H1
Vector VICTR74
Project tigm

Sequence tag IST14571H1HMR1
Sequence
ATCAAACGGATAACTGCTGGCTCAGACCGAGCTGGGTCAGGCCTGAGGACCAGACTTGGGGGCCAGGGCTAGGGGTTGGG
TCTCTCAAACCTAGCAGGGGAGCACAGANGTGGTCCACTTGTGTGTGTGTGTGTGTGGGGGGGGCTTTGGTGGCCCNGGC
AANCNNNNCTTTCTCTTGGCTATGACATCCCANACAGGGCANGTCTCCTCTTTNACCCTCTGTCTTCTTCTCTGTCAAAC
TGGCTTNNNCNNTNCTGGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14571H1BBF3
Sequence
GTCACAGGCCCTAGGAGAGAATCTACTGCTAACATTTGCTTTATGTATAAATTGCCCTTGTCACAACCATAGCCTGATGA
TGCTTTCAATCTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 146826156..146826250 91
NO GENE  


Sequence tag IST14571H1HMF2
Sequence
GATGGAGGGCATAGTCTCTTGTCCCCCTCCTGCCCCATGGGTTCCCAGCCCCCTACCTCCACTACCTGTGATATTAACAC
TGGGTGGCAGAGCTAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI22236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80880406..80880505 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es