Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14957G7
Clone ID IST14957G7
Vector VICTR76
Project tigm

Sequence tag IST14957G7BBF1
Sequence
TCTCAAAGTTTCCAATATTTGCTTAGAAAAGGAACCCAGAAGTCTGGGGAGGTGGATTAATGAGTAAAATGCTTATAAAG
CAAGCATGAGGACCGGAGTTCAAATCCCCAATATGTAAGTGAGGTGCACAGCTATAATCCCANCACTTANGANACAGGCT
CTCTANAGCACACTGGCTANTCAAGCCAATCANTGGGTTCANGTTCAGTGATGGAAGTTAANGTGGANNNAAACTGGANA
ANATGGTAATNTNAANGTCTGGTCNNNCNNNCNNANCNTGCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14957G7HMR1
Sequence
TTTTCTTTNAAAGATTTATTTATTTATTTATTTATTTATTTANTN
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54359428..54359469 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 99591086..99591127 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107101565..107101606 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32935251..32935292 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]


Sequence tag IST14957G7HMF1
Sequence
TCTCAAAGTTTCCAATATTTGCTTANAAAAGGAACCCAGAAGTCTGGGGAGGTGGATTAATGANTAAAATGCTTATAAAG
CAAGCATGAGGACCGGAGTTCAAATCCCCAATATGTAAGTGAGGTGCACAGCTATAATCCCAGCACTTAGGAGACAGGCT
CTCTAGAGCACACTGGCTAGTCAAGCCAATCAGTGGGTTCAGGTTCAGTGATGGAAGTTAAGGTGGACAGAAACTGGAAA
AGATGGTAANNNNNNTGTCTGGTCACACNCACANAACTTGCTTACATGCNAACCCACCTACNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129337750..129338050 279
 
EST/CDNA Est Name
  BY202509.1 - BY177177.1 - CJ101368.1 - CJ103741.1 - AI842393.1 - CJ183012.1 - CJ101021.1 - CJ102034.1 - BI202600.1 - CJ177533.1 - CJ186716.1 - CJ167784.1 - CJ102501.1 - CJ178623.1 - CJ177881.1 - CJ105616.1 - CJ178030.1 - BB857394.1 - CJ177972.1 - BB848485

 
Come back to gene BY202509.1 - BY177177.1 - CJ101368.1 - CJ103741.1 - AI842393.1 - CJ183012.1 - CJ101021.1 - CJ102034.1 - BI202600.1 - CJ177533.1 - CJ186716.1 - CJ167784.1 - CJ102501.1 - CJ178623.1 - CJ177881.1 - CJ105616.1 - CJ178030.1 - BB857394.1 - CJ177972.1 - BB848485


For any suggestions or comments, please send an email to unitrap@crg.es