Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14469B10
Clone ID IST14469B10
Vector VICTR74
Project tigm

Sequence tag IST14469B10BBF1
Sequence
AAGGGAAATTAAGTGCGAGAATAAAGGAGGCAAAACCATCCAGAAAAAGCAGCTAATCCAATTGAATGAAAAAGACATGT
TAGGTTTTTGTGCTGCATATTAATGCAATGTCTTGTTTGGTCAAAATTCACAATACACTTCTTGCTCCTCCTATGACTAC
AAAAGGAGTCAACACATTTTTTACATTACAAGTTTCCAATTCATGCCACTATCATGCAATGACTTAATCTTGACCCATAT
TTCCCTTACTGTATATGGAAAAATGCNCANATAACTTGTTTAACNGNNNACNNTTGAGAAGAGGGAAGCATGGTGTGTGT
GTGTGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72381008..72381334 309
NO GENE  


Sequence tag IST14469B10HMF1
Sequence
AAGGGAAATTAAGTGCGAGAATAAAGGAGGCAAAACCATCCAGAAAAAGCAGCTAATCCAATTGAATGAAAAAGACNTGT
TAGGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72381249..72381334 84
NO GENE  


Sequence tag IST14469B10HMR1
Sequence
CCTTCTAGGGAATTTATTCTTTGTATTGACTGTAAAGGAAATGCTTCTTTTGCACAAAGTATTTTATTTTAACGTAGAAA
TTTACAAGGTAAAGTGAAANTTTTTTNNNTGTN
Sequence Type genomic DNA
Unitrap ID UNI9013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72381331..72381436 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037674 (Rfx7) NM_001033536 regulatory factor X, 7 Gene [Source:MGI Symbol;Acc:MGI:2442675]

 
Come back to gene ENSMUSG00000037674


For any suggestions or comments, please send an email to unitrap@crg.es