Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11573C7
Clone ID IST11573C7
Vector VICTR76
Project tigm

Sequence tag IST11573C7HMF2
Sequence
CTAAGATTTGTACACTTTACCACATGAATGTCACTGCATTAATAAAATTAATAACCACCAAATACTTGGAAAATCACCTG
AAGCTAAAAACAACACCTGGAATTGAGGCTAATTCTCTAATCTCTCTACTCAAAATCTTAATCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88662666..88662812 147
NO GENE  


Sequence tag IST11573C7BBF1
Sequence
CTACTTCATTAGGTTCTGAATACAGCCCGTAAAACCAAAATATTTACCAGTATATCTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34404642..34404705 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es