Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10933A3
Clone ID IST10933A3
Vector VICTR76
Project tigm

Sequence tag IST10933A3BBF1
Sequence
CTCAGAATGAAGAATCAGAAGGGCTAAGGGTTCCTGGAAGGACAGGAGTGCAGAGTAGCGCATATGCAACTTTTAATTGC
TTCTTTCTCCCTCCCCAGTGCGTGTAGGTTTANAAGCCCANATTTCTTGCTCANGGAANGAGTTATGTGGGAGTCTTCTT
TTTGGGCAAGGGGACGAGATGGACTTGACCGTGTTGGCAGGTTTTGGTTCTTCTTTCCGGTGCCTGAAATGTAGCAGTTT
GTGGATCT

Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165704309..165704555 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es