Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14845C3
Clone ID IST14845C3
Vector VICTR76
Project tigm

Sequence tag IST14845C3HMR1
Sequence
AAAGAAGTTGATGATAAAGGAAAATTATGCGAAGAAAACAATAGAGGAGATAACAGATTTGTATTTTGTATTCAAGCACA
TTTTAAAATTCTTTACGTAAAATGACTTTGATTTAAATTTGCTGTGGTAAAATTCAAGAAAACATCAGTTCTTGGGACAC
TATGTGAATCACATAGGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI30985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135578720..135578901 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es