Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14810H12
Clone ID IST14810H12
Vector VICTR76
Project tigm

Sequence tag IST14810H12HMF2
Sequence
ACCCTAGCTATCTTAGTGGGTAAAGGGAACAAGACACAAAAAAAGAGTCCCAGGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38306617..38306674 58
NO GENE  


Sequence tag IST14810H12HMR1
Sequence
GGGTCTCACCTCCAGTCTTGTTTGATCTTAAAGTCTTGTTAATCTTAAAGGAAATACCAGCAAAGAAAATGAAGAGAAGG
AGGAAGAGGTTGTCCATTTCAGTCTCTCCGTTTCCTTGATTGCAGCAGTGTCTTTGTGCTGAAAAGTTTTAATGGTTTTT
TTTTTNNAATATTTNANTAANNTTCTTTNNNANNNGTGGGGGTANTGAAAATGTTTTAATTCCTTGTCCTAAACAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14810H12BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAACCATTTGTN
Sequence Type genomic DNA
Unitrap ID UNI27186 UNI31355 UNI31600 UNI35100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 57460958..57460990 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22240947..22240979 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5556219..5556251 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020481 (Ankrd36) NM_023816 ankyrin repeat domain 36 Gene [Source:MGI Symbol;Acc:MGI:1923639]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3297412..3297444 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9023991..9024023 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12826397..12826429 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8967946..8967978 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048424 (AC139209.10) RNB3L_MOUSE Isoform 2 of Q6PDH4 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6PDH4-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14140823..14140855 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7096292..7096324 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22867505..22867537 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32548130..32548162 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27478945..27478977 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14424959..14424991 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35143953..35143985 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53833473..53833505 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11358407..11358439 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3244845..3244877 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35066400..35066432 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 35045807..35045839 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166433: 26382..26414 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078424 (AC007307.77-204)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20141568..20141600 33
NO GENE  

 
Come back to gene ENSMUSG00000078424


For any suggestions or comments, please send an email to unitrap@crg.es