Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST427121
Clone ID OST427121
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST427121
Sequence
GTGGTATGGTGTGTTCCTGTGGGCACTGATGTCCTCTGTGTTCTTTCATGTCCCTGCCGGACTGCTGGCCCTCTTCACCC
TCAGACACCACAAATATGGTAGGTTCATGTCTGTAAGCATCCTGTTGATGGGCATCGTGGGACCAATTACTGCTGGAATC
TTGACAAGTATGTTAGACATTAAAATACCAGGTCAAAAACCGTGAAAA
Sequence Type mRNA
Unitrap ID UNI18231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114393450..114393654 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es