Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14588C12
Clone ID IST14588C12
Vector VICTR74
Project tigm

Sequence tag IST14588C12HMR1
Sequence
NNNNATGCNCNCNTNANGGCCGNGGNNCNNNNAAAANCCTGNNNGNNNNNNNGNANNNTNNNGNGGGNNNTTTGGAGGTC
CATTTCAGTAAAAAATTAACTCAGAGAGCAAAGGATCTAAGAAGTCCCTCCAGACCTAGCTCAGCTTTAAGTGAATCCAG
CATTTTAGTTTAGTTCTGTGCANATCAGCTAAGGTNNCTTTGACCTGAAAATATTGTGCCNCANACANNTNNNTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 53010878..53011034 147
NO GENE  


Sequence tag IST14588C12HMF2
Sequence
GTGAGCACGGACACAAGGAGATCACCGGGCTCCTGCTGGCTGTGCCTANCN
Sequence Type genomic DNA
Unitrap ID UNI19001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21574396..21574443 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es