Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14251D5
Clone ID IST14251D5
Vector VICTR74
Project tigm

Sequence tag IST14251D5BBF1
Sequence
ACACCAGCATTTCTCTTTTNAATAACTCTATGGTATTCCATATGGTAGCCCAAGGGACTAACCCTGACACACGATACACA
TAGGGTAGCATCCCATAGGATGGGGATAGGGGCTTCACATTTTTAGGACAACTCAGCCTCCCACAGAGAGCACCACAATT
CACATTATAGATGGGCAATTAAGGGCCAGCGGGTGATTACAGATGGCTCCTAGCTCCTGTCTTATAAAAGCCAACTAATT
TGAAAGTCAACAATAACTGAACTTCCTGGGTTGACATCAGCCGTCCTCAGGACCTCTTGGGGGTGAAGCCTGACTCCGGA
ATACCTTTACACAGAAATACCAGACCTTCCCAGGGCTGAAGTCATCTGTTTCCCAATAGCATTTCTCTCTCAAGTCNNAC
AGCACTGGGTGAGGCTGGAGACTTCNNNGGGCCNNGGTGTTTCTCCNNGACAGGCCTGGNNCCNNAGNTGTNNNNAGGAA
NCCATGGGACATGGANTGNCTCNNNNNNGNGCCCCGGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14251D5HMR1
Sequence
TNNGAGGNCCCAGANATTGGTTAAGAATATTTGTTGCGGGGCTGGAGAGATGGCTCAGCTCTTTTTTTTTTTTTTTTTTT
TN
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583763..106583840 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST14251D5HMF1
Sequence
ACACCAGCATTTCTCTTTTNAATAACTCTATGGTATTCCATATGGTAGCCCAAGGGACTAACCCTGACACACGATACACA
TAGGGTAGCATCCCATAGGATGGGGATAGGGGCTTCACATTTTTAGGACAACTCAGCCTCCCACAGAGAGCACCACAATT
CACATTATAGATGGGCAATTAAGGGCCAGCGGGTGATTACAGATGGCTCCTAGCTCCTGTCTTATAAAAGCCNACTAATT
TGAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583841..106584088 244
NO GENE  

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es