Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11635E10
Clone ID IST11635E10
Vector VICTR76
Project tigm

Sequence tag IST11635E10HMR1
Sequence
CCAGGTCTGCTGAGAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30634 UNI30798 UNI34161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3335180..3335237 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11356700..11356757 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13711835..13711892 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 10705344..10705401 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4813733..4813790 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053499 (EG432723) predicted gene, EG432723 Gene [Source:MGI Symbol;Acc:MGI:3644242]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 10919675..10919732 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9324746..9324803 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 7952828..7952885 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 18979429..18979486 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9202943..9203000 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15383269..15383326 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7374123..7374180 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12231080..12231137 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4196588..4196645 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5403825..5403882 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4042984..4043041 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3741701..3741758 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5242600..5242657 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3146235..3146292 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 923808..923865 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 431264..431321 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 827111..827168 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078466 (AC145587.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161913: 56537..56594 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165796: 457757..457814 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165798: 70074..70131 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079059 (AC147709.1)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 45506..45563 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 89109..89166 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 520932..520989 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 734357..734414 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 421861..421918 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 336108..336165 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166413: 611855..611912 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166417: 393796..393853 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166420: 79304..79361 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 8396532..8396589 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 336010..336067 58
NO GENE  

 
Come back to gene ENSMUSG00000079059


For any suggestions or comments, please send an email to unitrap@crg.es