Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10103C10
Clone ID IST10103C10
Vector VICTR76
Project tigm

Sequence tag IST10103C10BBR1
Sequence
AAGCACAATCTGCTCCAGGTGTCACCATTCTAGACAAGGATAATAGTCAAGCGCGGTGAATAATTTTGTAATTTAACCGC
ATGTATTAAATAATGCATGATATTAAATAAAATTAGATTGGTGGGTGCTTAGTTTGTGCAGGTTGGCTTGAGCCAGTGAT
AATGAATTTCTGTTTTAGGATCTGTACTATATAGATAGAATGTATCAGAAATGTAAAACACATGCCATTAACTGGAGCTC
TGTGTGTCAGATTATAGAC
Sequence Type genomic DNA
Unitrap ID UNI36755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176585778..176586029 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078877 (OTTMUSG00000016219) predicted gene, OTTMUSG00000016219 Gene [Source:MGI Symbol;Acc:MGI:3709624]

 
Come back to gene ENSMUSG00000078877


For any suggestions or comments, please send an email to unitrap@crg.es