Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11384G6
Clone ID IST11384G6
Vector VICTR76
Project tigm

Sequence tag IST11384G6HMF1
Sequence
TTAGCACCAGCCATTCCTTAGCTGACCTTTGCTGTGGACCAATCGGATACCATTCTTTCACCAACTGACCTTGAATTCAC
TTGCAGCCTTCACAGATCACCTGCCATTGTGATTCACGTTGTCCATCCTGTGGCAGCTTCCCTGACATTGACAACAAGAC
CTCANATCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99320430..99320600 169
NO GENE  


Sequence tag IST11384G6HMR1
Sequence
TAACACTCTGCACAGGATTGGTTTTAACTAGGGCTAGTGATGTTGCTTTTAAAGTAGTGGTAGGTGGGTCAGTGGGTGGC
CAGC
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99320350..99320432 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST11384G6BBF1
Sequence
TTAGCACCAGCCATTCCTTAGCTGACCTTTGCTGTGGACCAATCGGATACCATTCTTTCACCAACTGACCTTGAATTCAC
TTGCAGCCTTCACAGATCACCTGCCATTGTGATTCACGTTGTCCATCCTGTGGCAGCTTCCCTGACATTGACAACAAGAC
CTCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99320430..99320599 170
NO GENE  

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es