Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12524B6
Clone ID IST12524B6
Vector VICTR76
Project tigm

Sequence tag IST12524B6HMF1
Sequence
CCCTGAACCCCTCTTGACCCGAGGAACCACCAGAGATCCCCAGGATGAGGTCGGGGTCTCACCGCGCTCTGTCTGCAGGT
TCACATTCCTTGCGGTATTTGGTAACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGCTA
CATGAACTACATGCAGTTTATGCGCTTTGACAGTGATGGAACTACTCANAGGATCCAGGCGCGAGGGCCCTGGGTGAANC
ANATGGGGCCTGTGTATTTGNANATGGAAAGAANGAAAATGGANAGCNATTCNCACAGGGCCCGAAAAAACCTGCGATTC
NCAATCNANGTNNNNNACCNNANCGACAAGGGTGAGTGACCCCTTCACATCTCCNCAGACNNNTCTAANTCGCCNNNGGT
CCNNANCCCTANNTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12524B6BBF1
Sequence
CCCTGAACCCCTCTTGACCCGAGGAACCACCANANATCCCCANGATGAGGTCGGGGTCTCACCGCGCTCTGTCTGCAGGT
TCACATTCCTTGCGGTATTTGGTAACCACGACCGTGTCTGGACCANGTCTTCNAGATTCCCATGTCTTCATTGTTGGCTA
CATGAACTACATGCANTTTATGCGCTTTGACAGTGATGGAACTACTCANAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107922..37108136 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es