Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST427024
Clone ID OST427024
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST427024
Sequence
GTTTGAGGGACTTTCCTGGCTCTTTGTGCTGGTGTCCGACATCCACGTGATCGACTTTCACAACCCTTCNTATTCCATCA
GCATCACTTCCCACTACAAGCCTCCAGACTGCTCGGTGCTGAGTAAGAAGGGGGATTACCTCAAATACCACTACAATGCC
TCACCTCCTGGATGGGACTCTGCTGGACTCCACGTGGAACTTAGGCAAAACGTATAACATTGTGTTGGGGTNTGGACAAG
TCGTGCTGGGGATGGACATGGGTCTCAGAGAGATGTGCGTGGGAGAGAAGCGGACTGTGATCATCCCGCCCCACCTGGGC
TATGGAGAAGCTGGTGTGGATGGAGAGGTCCCTGGCAGTGCCGTCCTAGTGTTTGACATCGAACTGCTGGAGCTTGTGTC
TGGCCTTCCGGAGGGGTACATGTTCATATGGAATGGTGAAGTGTCTCCCAACCTCTTTGAAGAAATCGACAGGGATGGCA
ATGGGGAAGTCCTCCTGGAGGAGTTCTCAGAGTACATTCATGCCCAAGTGGCAACAGGCAAAGGGAATTGTGACACAC
Sequence Type mRNA
Unitrap ID UNI18245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 56818709..56828071 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029781 (Fkbp9) NM_012056 FK506 binding protein 9 Gene [Source:MGI (curated);Acc:Fkbp9-001]

 
Come back to gene ENSMUSG00000029781


For any suggestions or comments, please send an email to unitrap@crg.es