Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10099E4
Clone ID IST10099E4
Vector VICTR76
Project tigm

Sequence tag IST10099E4BBR1
Sequence
TTTGTAGACCAGGCTGGCCTTGAACCATTAATCTGAACGTTTTTGCTTCCCAAATGCTGGGATTAGAGGCATGTGACACC
ACTGCCCGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10099E4HMF1
Sequence
CAGAGTGAGTTCCAGGACAGCCAGGGTTACACAGAGAAACCN
Sequence Type genomic DNA
Unitrap ID UNI13538 UNI30772 UNI31392 UNI33575 UNI34813 UNI34814 UNI35286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 22360843..22360883 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58308152..58308192 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037990 (Sh3rf3) NP_766376 SH3 domain containing ring finger 3 Gene [Source:MGI Symbol;Acc:MGI:2444637]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4069898..4069938 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002129 (Sf3a1) NM_026175 splicing factor 3a, subunit 1 Gene [Source:MGI (curated);Acc:Sf3a1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4774287..4774327 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9781070..9781110 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8701589..8701629 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23562594..23562634 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 40375015..40375055 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35230343..35230383 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007036 (Bat5) NM_178592 HLA-B associated transcript 5 Gene [Source:MGI Symbol;Acc:MGI:99476]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34469863..34469903 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005871 (Apc) NM_007462 adenomatosis polyposis coli Gene [Source:MGI Symbol;Acc:MGI:88039]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5419105..5419145 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8376734..8376774 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 20803462..20803502 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47397475..47397515 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007613 (Tgfbr1) NM_009370 transforming growth factor, beta receptor I Gene [Source:MGI (curated);Acc:Tgfbr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5232129..5232169 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19612631..19612671 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19978165..19978205 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030400 (Ercc2) NM_007949 excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene [Source:MGI (curated);Acc:Ercc2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27292101..27292141 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12550773..12550813 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22527237..22527277 41
NO GENE  


Sequence tag IST10099E4BBF2
Sequence
CTTGGTCATAGAGAATTGGCTTCTAAGTTATTTGATCTAAGTATGATTAAAATGGTATAACAATGGTTACAAAGTTAGCT
TAAGTAGTAACTCAGGGCTAGAGTCATTTTCAAACAAAAGCACCTGGCATAAACCAGCCCAGAAAACTAGTCCCCTAAAG
ATACTTCTAAATTGAGATAATATTTTATGTAATTCTTATCCTAAAAAGTAGACTTATAGAGATAAGATTTTAAAACAGTG
TCTCTTTAATAAAACATTAAAATTTACACTGTCATGCATTCATAAATTGACAGCCAAACTTTGTAACGTGATAGTGATGT
TTCTAATATTGATTTTAAGAAAAATAAATTGTTTAAAATTGGGTCTTACTTTTCAAAAGTTATAGATATATTCTAATATT
ACAACGGAAACTTTAAAATGGTTAAAATTGGTTAAAATTGGTTAAAATTGCCAGTGTTCCATTGACTACAGCTTGCAGTT
TGATTTCAAATTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66730047..66730546 500
 
EST/CDNA Est Name
  CF897525.1 - AA726360.1 - CF897662.1 - CF898421.1

 
Come back to gene CF897525.1 - AA726360.1 - CF897662.1 - CF898421.1


For any suggestions or comments, please send an email to unitrap@crg.es