Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11603G3
Clone ID IST11603G3
Vector VICTR76
Project tigm

Sequence tag IST11603G3HMF1
Sequence
CATAGACCATCTCTGCTCATCAAGACCTGCCATGCTTGAACAATGGAATAGGCCTTCCCCTAAAGAGCCTTGTCTATCCT
CCCACCGGACCTGCACTCCANCCACAGTCATCAGCCNACCCAAGCCACCTTANCAGCCCAAGCCAACCGAAGCACCCTGA
GCAAGCCANACTCTTGTCCCCACGGTAAACTGTCNNGGCTCACCCCCTACCCTCCCTGGGCCANANTCCGTTTGAGAGCC
TGTTCTCAGCTCTTCCTNNACATACAGGGACGTCTGGTATGTCTGANACTGANAACCNNTCCANAGACCCCNNATTGCTC
CCTNTTTACCCCNGAGGGCTGGGGTACCNTGGCTTCCCACAGCCNGACCCCCACCTGTGTAGAGAGTGCTCGGCAGTCCC
CCACATCTGCCCGCNNAGAGCACCGGACCGGANCTTTGGCGGGACTCTCCCACCCCCTTTATTTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11603G3HMR1
Sequence
TATGGTTTTAGAGCTTTATTGCAGAAAGGCAGAGAAAACGAGAGAAGGTAAAAAAGGAGAGGCCGGCAGTGGCA
Sequence Type genomic DNA
Unitrap ID UNI20018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30685526..30685598 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]

 
Come back to gene ENSMUSG00000040850


For any suggestions or comments, please send an email to unitrap@crg.es