Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13471H8
Clone ID IST13471H8
Vector VICTR74
Project tigm

Sequence tag IST13471H8BBF1
Sequence
CCTTGGTGGAGGAGGGGGGCGGANCGAGGANAAGCAGAACCGGCGGCGGCCTTGGAGGAGCAGGAANAANAAATTCCTGC
TGAGTTCTGGATGACAGAAAGATANACTATTGTTGGACAGGACTGAAAGAAAGTCTTGCAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13471H8HMF1
Sequence
CCTTGGTGGAGGAGGGGGGCGGAGCGAGGAGAAGCANAACCGGCGGCGGCCTTGGAGGAGCAGGAAGAAGAAATTCCTGC
TGAGTTCTGGATGACAGAAAGATAGACTATTGTTGGACAGGACTGAAAGAAAGTCTTGCAAATCTCAAAAGGGTCAGCAT
CTGGATAAGAAACCCGAGCTGGGAAGCCCTAAGCTGTGTGCCTTCNGCGCACTGTAACCCTAAGGGAGGTGCTCATGTCA
ATCAAGTCTCACTANCCNATCAGGGCCTCCGGATAGGCAGGGCAATAGAAGTAGAGGCGTGTTCTTCCGTGTGCCTTGTT
CCGGTGCTCTGTGTTCCTTTCCGTTTCGAGCANGCTGAAAGCTTGGTCTGATTTGTTTTAATCTCTGCTGCCNNGGGCCT
TANGGAATTGCCAGCGATCTACNACGTGGCGACATGGTGAGCGTGTGACCACTGCCCTTANNCNNAANGAGCNNGGGTCT
N
Sequence Type genomic DNA
Unitrap ID UNI4711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62568023..62568502 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055228 (8430426H19Rik) NM_178875 RIKEN cDNA 8430426H19 gene Gene [Source:MGI Symbol;Acc:MGI:1918758]

 
Come back to gene ENSMUSG00000055228


For any suggestions or comments, please send an email to unitrap@crg.es