Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14113B3
Clone ID IST14113B3
Vector VICTR74
Project tigm

Sequence tag IST14113B3HMF1
Sequence
CTTTTCTACGAAGTAGTTGCATCTGCCGTCGATGGGAAATCCGATCGAGGGCGAAGTCGCCGCCGGAGCCTCCATAACGC
TGGGTCCTTTTGAAAGCCTGGCTCAGCCCAAAGTTGTCAGTCCCCTTTGGTCCCACTTCCCTTAACAAACGTGGCCGCCT
GAGGGGGGTGGGTCCNCGGAAATGACGCATCAGCCCGGCTCGGTCGGTGCCCGAACCGGAAAAAGGTGACNGTGGCTGAC
NAGGNCNNAAGCTCCTTCNTTCCNTNNGNTNNNCGNNNCCCTCCTCCTCCGCGGGAGCTGANCGCNNAACTCANACTCAT
CGGGACCGGCTCNNCNNTGCNGCCNGNACCGANNGCCNNNCCTACTGGGCTTNNTCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14113B3HMR1
Sequence
AAGAAGAAGCGCTTCTGCAGGATGGTGGCGGCCGCGGGGAAAAGGTTCTGTGGCGAACACGCTGGCTCCGCCGAGGTCAG
CTATCGCCCTCCCTTCCTGGGAGTCGCGGGTCTGTGGGTGCTGGACCCCAGTCTCGCCCCTTTGACAGGTTCCTGCTTCC
GTCCCATGGATTTAAGTAAATGCAGTTCTGCCCACCGCTCGGAGCCGCGAGGAGCCCCCGAGGAGCATTGCTTTCTN
Sequence Type genomic DNA
Unitrap ID UNI19507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116297396..116297631 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

 
Come back to gene ENSMUSG00000033439


For any suggestions or comments, please send an email to unitrap@crg.es