Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10066G12
Clone ID IST10066G12
Vector VICTR75
Project tigm

Sequence tag IST10066G12BBR1
Sequence
CTGTCTGGGTCCTATTTCCGCCCCAGCCATCTTGACTACACAAGCCTAAAGGAGAGAGAGGCCTTGTTTCTCAGAGAAAA
CAGACAGAGGCCCAGGGAGGCTTCTCTCAGCATGAGCCTGCACACTCACTTTTGCATTTGCATCTGTGTATGCAAGTGCA
CAGATGTGCGCGCGCAAACACACACACCACAGCCACCACCACAATACTGGCTGGTTTTGTGCTAACTTGACACAAGCTGG
AGTCACCACAGAGAAAGGAGCTTCAGGTGAGGAAGTGTCTCTATGAGATCCAACTACAAGGCATTTTCTCAATTAGTGAT
CAAGGGAGAACGGCCCCTTGTGGGTGGTGCCATCCCTGGTTCTATAAGAACCAGGTTCTATAAGTCTTGGTTCTATAAGA
GAGCAGGCTGAGCAAGCCAGAGGAAGCAAGCCAGTAAAGAACATCCCTCCATGGCCTCTGCATCAGCTCCTGCTGCCTGA
CCTGTTTGAGTTCCAGTCCTGACTTCCTTTGGTGATGAACAGCAGTGTGGAAGTGTAAGCTGAATAAACCCTTTCCTCCC
CAACTTGATTCTTGGTCATGGTGTTTGTGCAAGAATAGAAAC
Sequence Type genomic DNA
Unitrap ID UNI32595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144001877..144002478 598
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]

 
Come back to gene ENSMUSG00000074758


For any suggestions or comments, please send an email to unitrap@crg.es