Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11389H4
Clone ID IST11389H4
Vector VICTR76
Project tigm

Sequence tag IST11389H4HMR1
Sequence
GATTAATAACAGAAAATCCTAAGCTAAAGTTAGTGCTGCATAGTCCGGTCAGGGACTGGTGAAGTGTCCACACGGCACAC
ACTGACCTCAAGTTTCTTCTCCAGAACCACAAAAGCAAAATGGGTTTGATAAGCCACCAAATTAATCTTTGAGCTGTGGC
CCCACCTTCTTTGATTTTTCTCTTTTAAGGGATCATCTGCACTCTGATCTGGGACTTATGCTTCATGTTATTGCTATTTC
TCTCAACAGAATCAACCGGTCTTTCTCAACCTGCTNCNNAACTGCACACTGCCTTTGCAAACATTCCACTCCTCNGGTAT
CCAATTCNNATNNAAAGAGCAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4798771..4799114 328
NO GENE  


Sequence tag IST11389H4HMF1
Sequence
AATCCTTGGGTTGCCTTCTGTTTAATTGAGTGATTATCTGGCTGAAACTTGTGTTGTATAAGATTGTCAAACTTTTACAA
TGAAACTGGGGAGATGGTTTAATGGTTCAGGGCATANGCTGCACTTAACCAGCCTGCNGGTTCAGTTCCNAGCACCCACT
TANTGGCTTCCAGCTCGCTGTAACTCCAGTCTCAACAGATCTGACCCCTTTTCTGGGCTCCACANGANTCNNATATNTGT
GGTGTATANGCNTACATGCANGCNAAGCATTTGTACACATAAAATAAATATAAAGGTTAAATTTTTANAACTTGATTTTA
TTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11389H4BBF1
Sequence
AATCCTTGGGTTGCCTTCTGTTTAATTGAGTGATTATCTGGCTGAAACTTGTGTTGTATAAGATTGTCAAACTTTTACAA
TGAAACTGGGGAGATGGTTTAATGGTTCAGGGCATAGGCTGCACTTAACNNGCCTGCGGGTTCAGTTCCAAGCACCCACT
TAGTGGCTTCCAGCTCGCTGTAACTCCAGTCTCAACAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4799111..4799313 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es