Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11088E11
Clone ID IST11088E11
Vector VICTR76
Project tigm

Sequence tag IST11088E11BBF1
Sequence
CTTGAAGACCGATCATTGCATATCTTTTGCACAGACATGTCTTAGTTTTGTTTTCTATTTTATTGACACATGATTTAACT
AGTTAATCTTGATGGAACTTTAGAATTGTTCTAGTTTTTTGCTAGTACTAACACTAATGAATATCCCAGTAAGTGCAATA
TTAATATGTAAGTTAAATTCCTAGAAACTCTTTCCCTTTGGAAGTAGTGACTTGAAATTGAAATTGTTTGCTAATACCAT
GATCTACAAGACATACACCTAAACAGTGGAGATTAAGAAGTGGCTTTTGAGATACTGATGCAGGTAAGTAATGAATTACT
TGTTTGCCGCATGACATGCAGATTGCTTTCACATACTGTTGTTTTAGTAATACAGAGTTTTAACTAGAATGAGTTTTAAA
ATACNGTGCCTGCCAGTGTTGATGAAGGAAGTGTTTCTACTTTCTCTCACTTTTTGGGACTTGATATACTGGATAAGATG
TTAATATATGATATTAAATGGTAAGCTTGNTTTTNNAAAAATGCCNNGNANAGTCTN
Sequence Type genomic DNA
Unitrap ID UNI10419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40077093..40077628 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]

 
Come back to gene ENSMUSG00000038481


For any suggestions or comments, please send an email to unitrap@crg.es