Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426851
Clone ID OST426851
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426851
Sequence
ACTGAGCTCCTGTCCCCTGAGGACTACCAGCGTTTCCTGGATCTGGGTGTGTCCATCGCAGAGAACCGAAGCACCTTGAG
CTACCACTGCAAGACCCCCGACTGCAGGGGTTGGTGCTTCTTTGAGGATGATGTCAACGAGTTCACCTGTCCTGTGTGCA
CCCGTGTCAACATGCCTGCTCTGCAAGGCCATCCATGAGCACATGAATTGCAGGGAGTACCAAGACGACCTGGCCCTGCG
GGCTCAGAATGATGTGGCTGCCCGGCAGACGACAGAGATGCTAAAGGTAATGCTGCAGCAGGGCGAGGCCATGCACTGCC
CACAGTGCCGGATTGTGGTGCAGAAGAAGGACGGCTGTGACTGGATCCGCTGTACAGTCTGCCACACTGAGATCTGCTGG
GTCACCAAGGGCCCACGCTGGGGCCCAGGGGGCCCAGGGGACACCAGTGGTGGCTGCCGCTGCCGGGTCAATGGGATTCC
ATGCCACCCAAGCTGTCAAAACTGCCACTAAGTCGACGATGGNGGCTCTCATACTGACCCAGCCCCGC
Sequence Type mRNA
Unitrap ID UNI18258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152142535..152145041 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027466 (Rbck1) NM_001083921 RanBP-type and C3HC4-type zinc finger containing 1 Gene [Source:MGI (curated);Acc:Rbck1-002]

 
Come back to gene ENSMUSG00000027466


For any suggestions or comments, please send an email to unitrap@crg.es