Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10458E9
Clone ID IST10458E9
Vector VICTR76
Project tigm

Sequence tag IST10458E9HMR1
Sequence
CACAATTTAAAACATAAGTAAGCTTTATATTTAAGGACTTTTTTGAGCCTCATTATATGATCCTGGCTGGCCTGGAACTC
CTGCCTTCGCTCATGAATGCTGGAATTAAATGTATTCACTACCACATCAAGCCCTANAACTTAATTTAATTATAGAAAAA
TTAAACAGCTAGTGTATAACCACGTGTTTTATTTTCTCANTAACATATACTTCCATGACACGTTTTTTTGTTTTTTTTTA
CTATTAATGGAACAATGTTGTTACNTTATTAATTGAGGGCATGCNCCNANTN
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21776077..21776363 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]

 
Come back to gene ENSMUSG00000028248


For any suggestions or comments, please send an email to unitrap@crg.es