Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426800
Clone ID OST426800
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426800
Sequence
AACTCTCAACTATGATATCTACACCCTGCGGAAGATCCGCAGGGAAGTGAGGAACCGATGGAGACGAATCTTAGAGGACT
TGGGCTTTCAAAGGGAAGCCGACTCTGTGNTGTCAGTGACCAAACTCAGCACCATGAGTGATTCTAAAAACACANGGAAA
GCCCGGGAGATGCTGTTAAAGCNTGGCTGAAGAGACCTNTATCTTNCCCGCCAGCTGNGAGCTCTNCGNGAGGTACCTCT
TGGTTGTGGACCGGCCTCATTGCTCTCGATGCCTGCNTGAGGACCNTCTTTAANATTGCTAGTTCAAATGTACCCAAAGA
AACCTGGGGTTCCATGCCTGGCGGACGGCCANAGAAAACTGCACTGCCTTCCATTTCCAAGCCCCCTGAAGGNAGGCCCA
NANGAGCCGGNGTTCTTTTTACCACGACACACGAATTTTACCAT
Sequence Type mRNA
Unitrap ID UNI371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72207408..72210724 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es