Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14466E12
Clone ID IST14466E12
Vector VICTR74
Project tigm

Sequence tag IST14466E12BBF1
Sequence
AAATAAACCAAAAAGCAAGTTGAGACTTGGCAGAAAACAAAAATATTGAAAAGCAACACAAATGAATTATAATCCCTGTT
GANATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88377595..88377683 87
NO GENE  


Sequence tag IST14466E12HMF2
Sequence
GTCCTGGAAGCTCCTAGCCTCCATACAATCTTATCCAGGCCTAGAATGTTTTCATCCTCTGAAGCTTACTCATGAATATG
CTCACCCTTCCTAGTTCTTTCTGAACTCTGTCTGACTCAAACTCCTCTCCGAACTGACCGATTCNNTCTGGCTTCTCTTG
NCNTCTCCNGANNTGCNNTGCTTGNCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14466E12HMR1
Sequence
GGACNNGGCCTTGAACTTAGCAGATGGCAGTAAGCCTCAAAGANAACAATTACATCAGGCGAATAAAAGTTACAACAGTT
ATTCATACTGGAGATATTAGAGGTCAAAGTTGGGATTCGTGTGCTAAAGTCTTTTCTTACTGAGTGCTACGCCAGTGATC
TATGTCTTGGCATGCTGTTTCCGGGCGTGGGATGATTTGTTCAGCTTGGGCTTCCATGATGCCCTTTAAAATGTGACTGC
TGCANNACTGTGCGTCCTGTGAAATGTGCNTGTTTNANTTTCCNNGCANCCN
Sequence Type genomic DNA
Unitrap ID UNI24141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8922105..8922395 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es