Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12533F11
Clone ID IST12533F11
Vector VICTR76
Project tigm

Sequence tag IST12533F11BBF1
Sequence
TATAGGTCGAGGTTCCCTTACCACANNNGNNCCCATCTACCTGAGTCAGCACCTCCTGCTTGCAGATGCACTCATCTCCC
TGACTCAGCACCTTCTTCTGCAGGTGTACCCATCTCTGTGGCTCANCACCTCCTGCTTGCAGGTGTATCTATCCCCATGA
CTCAGCATCTCTTACTGCAGGTGCACCCATGTCCCTGATTCAGCATCTCCTATTGCAGGTGCACACATCTCTGTGACTCA
GCATCTCCTATTACAGGTGCATCCATCTCTGTGACTCANCATCTCCTATTGCAGGTGCACATATCTCTGTGACTCAGCAT
CTCCTATTGCAGGTGCACATATCTCTGTGACTCAGCATCTCCTATTGCANGTGCACCCATCTCTGTGACTCAGCATCTCC
TATTGCAGGTGCACCCATCTCTGTGACTCAGCATCTTCTATTGCANGTGCACATATCTCTGTGACTCANCATCTCCTATT
GCAGNTGCACCCATTTCTGTGACTNNNCATCTCCTATTGCANGTGNNCCCNTCTCN
Sequence Type genomic DNA
Unitrap ID UNI36763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25044857..25045391 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es