Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10080F2
Clone ID IST10080F2
Vector VICTR75
Project tigm

Sequence tag IST10080F2BBF1
Sequence
GCCTGGGCTGTCCTGGAACTCACTTTGTAGACCAGGCAGGCCTCGAACTCAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16838 UNI36764 UNI36765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117145238..117145296 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45179021..45179079 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 75315067..75315125 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035765 (Dym) NM_027727 dymeclin Gene [Source:MGI Symbol;Acc:MGI:1918480]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42947246..42947304 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27846778..27846836 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026837 (Col5a1) NM_015734 collagen, type V, alpha 1 Gene [Source:MGI (curated);Acc:Col5a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94439063..94439121 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005968 (Tuft1) NM_011656 tuftelin 1 Gene [Source:MGI (curated);Acc:Tuft1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135710619..135710677 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96709419..96709477 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 153455460..153455518 55
NO GENE  

 
Come back to gene ENSMUSG00000005968


For any suggestions or comments, please send an email to unitrap@crg.es