Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12655C12
Clone ID IST12655C12
Vector VICTR76
Project tigm

Sequence tag IST12655C12BBF1
Sequence
CTTTNACGGAACGCCGTCGTTTCTCGGCTCAGGCCCCGCTACGGCCCCGCCTGGGCCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648297..91648360 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]


Sequence tag IST12655C12HMF1
Sequence
TGCCTAACCGAGGCCTCTGGGATCGGTGTNNNNTGGGCGGTAACCGGCTGGANAAAAGGCCAGTGAGCCCCAAAACCTGT
TAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es