Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426737
Clone ID OST426737
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426737
Sequence
TGAGGCTTTGCACACTATGAACAATCTGCTGATTACTACAAAGGAGAGGAATCTAACAGCTCTGCCAACAAGTGTCTGCT
GAAGGTGGCAGCCTACGCTGCACAGCTGGAGCAGTACCAGAAAGCCATCGAGATCTATGAGCAGGTGGGAGCAAACACCA
TGGATAACCCCTTGTTGAAGTACAGTGCAAAGGATTACTTCTTCAAGGCCGCGCTCTGCCACTTCATAGTGGATGAGCTG
AACGCAAAGCTTGCTCTGGAGAAATACGAGGAAATGTTTCCAGCATTTACGGACTCCAGAGAATGTAAATTATTGAAGAA
ACTTCTAGAAGCTCATGAGGAACAGAACAGTGAAGCGTACACTGAAGCAGTGAAGGAGTTTGACTCAATATCACGTTTGG
ATCAGTGGCTGACCACCATGTTGCTTCGTATCAAGAAGTCCATCCAAGGGGATGGAGAAGGAGATGGAGACCTCANGTGA
AGNGCTGACATCTTTGNGGCATGCAGCTCATTCCTTTTTATTTTGTCTT
Sequence Type mRNA
Unitrap ID UNI18264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 148523083..148529063 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027438 (Napb) NM_019632 N-ethylmaleimide sensitive fusion protein attachment protein beta Gene [Source:MGI (curated);Acc:Napb-001]

 
Come back to gene ENSMUSG00000027438


For any suggestions or comments, please send an email to unitrap@crg.es