Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14381A2
Clone ID IST14381A2
Vector VICTR74
Project tigm

Sequence tag IST14381A2HMF1
Sequence
GCTGACCTTTAACTGATCCTCAAGCCTCCGCCTGATAGTGTTAGGGTTACATAGGCATACACCATCACGGACCTAACAAA
GTGTCTGCAGGACACATGAACATACTTAAAATCCACACTTTAGCTGAGTGACGCTTACTTATGGAACTCTAGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3532488..3532642 155
 
EST/CDNA Est Name
  CD553020.1


Sequence tag IST14381A2HMR1
Sequence
GCTGCACATGCATGAGTTCTTGAGTTCAATTCCAAGTTCCCGTGTAAACCGCTGGGCTGGGCTTGGTAGTACACACCTAT
AATCCTGGCATTCGAGAGGCAGACAGAGGGGCTCCACTGGGCTTAC
Sequence Type genomic DNA
Unitrap ID UNI17944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96824320..96824445 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es