Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0847
Clone ID GC0847
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0847
Sequence
CTGGCTGCACCACCACTGGTGTTCGAATGATCGCCTTTCCCAGTGCTGGCTGCTGGAGTGGCGTTCTAAGCCCTGCCCCG
CCCCGGCGGATCTGAGCCCCTGTGATCACCTGTGATGTGGTAGTGGTTCCTGCAGAGGCTGAGGTATTGGGCCTAATTGT
GACAGTTGCAGTCCTGGGCTGGAATGAAGTAAAGGTTTGCTGGCTTGGACCTGTAGTCGATGGAATGATCCCCAGGACCT
TCTGCTGTACCTGGACCATGCCTGAATTGGACTGG
Sequence Type mRNA
Unitrap ID UNI319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106921786..106923863 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es