Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426607
Clone ID OST426607
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426607
Sequence
ACTGAGCTGCCGACTACAGGTCCATTCTGAGCATTAGTGACGAGGCAGCCAGGGTGCAGGCCCTGGACCAACACCTCAGC
ACGCGTAGCTATATCCAGGGGTACTCCCTATCCCAGGCAGATGTGGACGTGTTCAGGCAGCTCTCGGCCCCTCCCGCTGA
CTCAAGGCTCTTCCACGTGGCTCGGTGGTTCAGGCACATAGAAGCGCTCCTGGGTGGCCCCCAAGGCAGAGACGAGCCCT
GCAGGCTTCAAGCAAGTGAGTAACAGCAGTGAACCTCTGCTTCAAGGTCAAGGGCATGAGGTGCTACAGGGCAGTGGATA
TCCTGCTGGAGACTCACCTCCATATTTCAGTCAAGTGTTCCTGTGGGGCAGAAGCCATGCTTGTTGGGTCTGGTAGGATA
AAGTCATGTAACCAACATGTAGCTCAGCGCCACCTTTGGGACCACTTCAGGGCCATACTAGATGCTGTTACAGACCTGTC
TTGGGGTTCCACTAATGCTTTGATGGGAGTGGCTCTTGGTTCTTGTCTTTAGTCCCATAGGTTACATTTGTTTGGG
Sequence Type mRNA
Unitrap ID UNI154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150778019..150778567 549
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es