Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14654F5
Clone ID IST14654F5
Vector VICTR74
Project tigm

Sequence tag IST14654F5HMF2
Sequence
GATCCACTTGTCTCTGCCTCCCCCAGTGCTGGGATTAAAGGTCTGCACCACCACACCCAACTAATCAGGCTTTTTGACAT
TTGGTTTTATATTTGAGGACTTTATTAGTAGGAGAAAAATCTTGTTTTTTCTTTGCTTTATATTTCATTTGTTGCTTACT
AAGGCTGTTTGCTGTTGGTTTTGAAATGGCGGTGGGTAGGCACAGGTATCTGTCTGGAGTCACAGACTATCTGTGTGAGG
TTGGATCANGGGAGCCTTTCTCTATCACTGTGTGCTTCTGGGATGTTTGCGTTCTGGCAACTTAGCGTTTTTGCACTCAC
AAGGATGAACATGGAGGTGTGCACTTGGTACAGANACTGGCAGGAAGGTCACAAGAGTGAAGTCAATCAAGANCAAGANA
GGCAAAGTTTTTNAAAAAATCATTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33012194..33012620 416
 
EST/CDNA Est Name
  BY719028.1 - BY320686.1


Sequence tag IST14654F5HMR1
Sequence
NATCTCTGTGAGTTTGAGGCCAGCCTGGTCTACATAGGGAGTTCCAGGACAATCAGCACTATATAGAAGGACTGTCTNAN
ACAGTAACAACAACGCATGATTAGTGCTGAGCCCTGCTGGTCACTGCTCAGGAANAGGGGCTCTCCCACAGAGAGCANCT
GANAATATGTGCTATATTTAGAGGACAACTTTATCCAGGTTTTATATGATTTCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33011980..33012196 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14654F5BBF1
Sequence
AAGCAAATGAAACTGAATAGCATGGTGTANCCAACTCCTGCTTTTANAGTGCTTANCACAGTGCTGGCATCAAGTAAGTT
TGTTGCTTTTGCCATTATTGTGTCTTAATGCAAAAGGTANACTGGAAACAGTGTTACCTTCTTCATTTCCCACAGTCCTC
TGTCAGATCCCAGTACAGAAAGCAGGCAACCAGCGGGCTTGCCAGGCAGCAAAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI9347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156545954..156546173 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061689 (Dlgap4) NM_146128 discs, large homolog-associated protein 4 (Drosophila) Gene [Source:MGI (curated);Acc:Dlgap4-001]

 
Come back to gene ENSMUSG00000061689


For any suggestions or comments, please send an email to unitrap@crg.es